Bioinformatics

1. Restriction endonucleases are enzymes that hydrolyze DNA molecules into smaller fragments. These enzymes recognize particular DNA sequences and cut the DNA near or within the recognition site. For example, EcoRI, a commonly used restriction enzyme, recognizes GAATTC, and cut between G and A. For a DNA string that has a sequence TTACGAATTCGG, EcoRI will cut it, between the 5th and 6th bases, into two pieces, TTACG, and AATTCGG. Write a python script that search DNA sequences for EcoRI sites and report (print) the position (cut site) for the user. For practice, you use the following DNA string to test your script.

GGAGCTTTGAATTCTTTCCGAATTCCCAGCTTGAATTCCCATTGATCTATGAATTCATGATCATA

2. In molecular biology laboratories, two or more restriction enzymes may be used simultaneously. Write a python script that search for EcoRI site and Alu site (recognizes AGCT, cut between GC) simultaneously, and print fragment sizes (bases) for each fragment atfter cut. You may also use the practice sequence for your practice.

TAKE ADVANTAGE OF OUR PROMOTIONAL DISCOUNT DISPLAYED ON THE WEBSITE AND GET A DISCOUNT FOR YOUR PAPER NOW!

Unlike most other websites we deliver what we promise;

  • Our Support Staff are online 24/7
  • Our Writers are available 24/7
  • Most Urgent order is delivered with 6 Hrs
  • 100% Original Assignment Plagiarism report can be sent to you upon request.

GET 15 % DISCOUNT TODAY use the discount code PAPER15 at the order form.

Type of paper Academic level Subject area
Number of pages Paper urgency Cost per page:
 Total: